Tuesday, July 23, 2019
MGMT345 U4 DB Assignment Example | Topics and Well Written Essays - 250 words
MGMT345 U4 DB - Assignment Example r the 12 weeks leave are such as when the employee gives birth and has to take care of that child; is under placement for a child as a foster; seeks to care for their spouse, child or family member with serious medical conditions; the employees themselves are seriously ill and cannot discharge their duties normally; or when there is a succeeding exigency arising from the circumstance that the employeeââ¬â¢s spouse or child is actively covered with the military. For the 26 weeks leave, may arise when an employee seeks to attend to a spouse or child seriously injured and is a covered service member (Aitchison & United States, 2003). This Act can affect an organizationââ¬â¢s operations in two dynamic ways. First, the organization would need to reinstate the employee to their original position or a similar one should they return to work after the leave; thus, likely to affect the firmââ¬â¢s productivity. Second, the company would be required to continue offering the medical coverage for the employee, despite being away on leave. Finally, with this new Act, the organization is required to put up posters at all places that inform the employees of its contents, which may be costly to the
Monday, July 22, 2019
Achieving Morality Essay Example for Free
Achieving Morality Essay The external factors play a huge role in shaping oneââ¬â¢s decisions. One may think that his genetic and background history has the most influence on his actions, but in reality, the intensity of a given situation has greater impact in the choices of the individual. The surroundings one lives in ultimately influences his perception, decision, and morality. In his essay, ââ¬Å"The Power of Context,â⬠Malcolm Gladwell states how it is the little things in life that makes the bigger difference and in many aspects this is true. In Daniel Gilbertââ¬â¢s essay, ââ¬Å"Immune to Realityâ⬠he talks about how human perception about reality is not always accurate. In Oliver Sacksââ¬â¢s essay, ââ¬Å"The Mindââ¬â¢s Eyeâ⬠he shows how there are many different perceptions to view the world. So at the same time, is it possible to dictate what is right and wrong in oneââ¬â¢s life if all the decisions are a result of his given situation and surroundings? Also the morality for each person varies depending on their circumstances and perception of their world. Ultimately, an absolute form of right and wrong does not exist because the context of the situation always changes, but still it is possible to achieve an applicable standard of morality in society. Each individual has his own way of looking at the world that is completely unique when compared to the way another person does. This is perception of reality and this form is always open to discussion because the person generates this viewpoint. Each individual makes his decisions based on his perception of the world. ââ¬Å"The processes by which we generate positive views are many: we pay more attention to favorable information, we surround ourselves with those who provide it, and we accept it uncritically (Gilbert 134). In many instance one creates his own perception to suit his way of thinking, so the individual could be in the center of his world. ââ¬Å"He seemed to regard this loss of visual imagery as a prerequisite for the full development, the heightening, of his other sensesâ⬠(Sacks 304). Most people see becoming blind as unfortunate event, but according to this person it helped him to improve his other senses. ââ¬Å"The tabloids dubbed Goetz the subway vigilante an d the death wish shooterâ⬠(Gladwell 153). Rather than seeing Goetz as a lunatic the newspapers depicted him as a hero. So this shows the difference in perception between people and how it varies from individuals. Importantly since each personââ¬â¢s perception varies it is hard to claim whose perception is right or wrong because ultimately is there a ââ¬Å"rightâ⬠perception of the world that everybody should be following? Even when viewing a painting everybody has their own interpretation of the art. No one claims there is only one ââ¬Å"rightâ⬠perception; rather the different perceptions are simply different approaches towards looking at the world. ââ¬Å"It was simply inconceivable that someone could pull a gun on someone else on the subway and be called a hero for it.â⬠(Gladwell 154) shows how different viewpoints affect the verdicts of a situation. A hero to some people might be a villain to others and it is hard to claim who is the ââ¬Å"rightâ⬠hero. The difference in subjectivity among people will always create a discrepancy of opinions among people. Since a variety of perception exists, then is it possible to have a perfect set and stone ââ¬Å"right and wrongâ⬠rules in life? The context of a given matter plays a huge role in deciding the morality of the event. Morality is very much depended on the background information of the event. It is very hard to dictate the morality of an issue without seeing the bigger picture. Most people might see stealing as a wrong act, but what if someone stole a piece of bread in order to make sure he does not die from starvation, is that still a wrong act? In a situation like that one might feel sympathetic to that poor fellow and probably will see stealing as reasonable in that given situation. ââ¬Å"We do not realize that our views will changeâ⬠(Gilbert 135), the idea of morality varies on the situation because the context of the event directly affects morality. ââ¬Å"Blindness now becomes for him a dark paradoxical gift. This is not just compensation, but a whole new order, a new mode of human beingâ⬠(Sacks 305), in many aspects blind people do not see their condition as a curse or burden rather a different approach towards living and for most sighted people it might be hard to understand and accept this approach. ââ¬Å"That there are instances where you can take normal people from good schools and happy families and good neighborhoods and powerfully affect their behavior merely by changing the immediate details of their situationâ⬠(Gladwell 162) this shows how the little details of an event plays huge role in the outcomes of an event. Essentially, context of a situation is what dictates morality and it is going to be almost impossible to label morality as set and stone as something like the Ten Commandments because the context always changes. Even though the standards of morality vary according to the situation there are some aspects of morality that one subconsciously accepts. Some ethics are universally considered wrong and oneââ¬â¢s mind without even one knowing already knows that some choices are not right. That is why the mind tends to usually question the choices one makes. ââ¬Å"When we cook facts, we are similarly unaware of why we are doing it, and this turns out to be a good thing, because deliberate attempts to generate positive viewsâ⬠(Gilbert 134), subconsciously to some extend individuals are aware of the morality behind an action and this will help individuals to make their decisions wisely. ââ¬Å"To what extent are we our experiences, our reactions shaped, predetermined, by our brains, and to what extend do we shape our own brainsâ⬠(Sacks 303), There are some emotions and judgments that are simply preinstalled in oneââ¬â¢s mind which aids an individual in making choices that are difficult. ââ¬Å"After a while the bad guys wised up and began to leave their weapons home and pay their faresâ⬠(Gladwell 157) this shows how there is a consciousness inside individuals that helps in guiding with decision making. When making a choice that might inflict pain to us or others oneââ¬â¢s mind will usually try to suggest against that decision. That is why the idea of taking an innocent personââ¬â¢s life is universally seen as a wrongful act in societies. Therefore, there is a sense of unconscious morality that lies within the hearts of most individuals. Achieving a complete form of morality is a very idealistic thought because practically itââ¬â¢s not possible. There are infinitely many ways of perceiving morality and it would be impossible to set a standard that would suit all the time. ââ¬Å"Too often people with sight donââ¬â¢t see anythingâ⬠(Sacks 310). There are parts that even oneââ¬â¢s eye sometimes cannot capture meaning that sometimes itââ¬â¢s simply not possible to account for all the possibilities. ââ¬Å"The benefit of all this unconscious cookery is that it works, but the cost is that it makes us strangers to ourselvesâ⬠(Gilbert 135). People sometime engage in activities without being aware of the magnitude of the situation. â⬠They are both based on the premise that an epidemic can be reversed, can be tipped, by tinkering with the smallest details of the immediate environmentâ⬠(Gladwell 157) the intensity of the situation has a huge influence on the decision of the individual. Due to all this, perceiving morality completely would be very difficult. Also having a perfect morality would require infinite knowledge which humans do not possess. As an individual one is limited at what he observes at a given time and there are limitations for each individual in this world. However, through the perceptions of many individuals, people will be able to come up with a better understanding of morality. Even with the limitations each individual has a small understanding of morality in the back of his head. Essentially, when all these understanding that are possessed by individuals are combined then a suitable set of standards will be formed that can accompany most situations. The collective effort of people will help to generate a better set of morality that will help in creating a peaceful environment for people to live in. That is why it is important to have many different perceptions of morality because they all eventually lead to creating appropriate rules that will be suitable for the well-being of a society. Despite not being able to have an absolute morality with infallible accuracy and with infinite knowledge, an applicable method of sensing morality is still practical. Individuals lack the ability to have a perfect morality because for one to acquire it in completion one needs to possess infinite amount of knowledge. Despite this back drop each individual innately has the ability to know morality in small parts and therefore combining the small parts of every individual will help to achieve a suitable set of codes. The differences in perception between people only aids to benefit humans in portraying a better understanding of morality. That is why it is important that there are different types of perceptions because if there was only one view then a very limited and narrow minded principle would be prevalent in the world. The different pathways of thinking done by people finally leads to achieving a suitable mode of morality. An absolute form of morality will never be possible in this imperfect world, however, that does not mean accomplishing a reasonable standard is impossible.
Sunday, July 21, 2019
Heteroplasmy and Response Against Azoxystrobin in Cercospora
Heteroplasmy and Response Against Azoxystrobin in Cercospora Introduction The quinone outside inhibitor (QoI) or Strobilurin is one of the most important fungicides used to control fungal and some Oomycetes pathogens in agricultural crops. This class of fungicide was first isolated from a wood-rotting fungus called Strobilurus tenacellus. Several chemically modified derivatives of natural fungicide, Strobilurin A, are available which are more stable, efficacious, less harmful to human and environment. These fungicides are commercially available with different names and active ingredients: azoxystrobin (Syngenta), fenamidone (Bayer), fluoxastrobin (Arysta), kresoxim methyl (Cheminova), pyraclostrobin (BASF) and trifloxystrobin (Bayer) (Bartlett et al., 2002; Vincelli, 2012). QoI fungicides exhibit both translaminar (across leaf blade) and weak systemic movement within the plant. All QoI fungicides have the same mode of action which disrupt mitochondrial respiration and prevent energy production inside fungal cells (Vincelli 2012). The disruption of ATP generation occurs because of binding of strobilurin at Qo site of cytochrome b hence preventing electron transport from cytochrome b to cytochrome c1 (Bartlett et al., 2002). QoI fungicides are applied to control a broad range of plant pathogens including fungi, water molds, downy mildews, powdery mildews and rusts (Vincelli, 2012). They are mainly used as protective and curative fungicides because of effective action against spore germination and penetration (Balba, 2007). The eradicative property has also been reported by preventing sporulation of fungal pathogen (Anesiadis et al., 2003). More than 50 species of plant pathogens resistant to QoI fungicides has been reported and there is a high risk of selecting resistant isolates in the field (Fungicide Resistant Action Committee, 2013). Three different point mutation in mitochondrial cytochrome b gene has been associated with resistant mechanism against QoI fungicide. The primary mechanism of resistance is by amino acid substitution from glycine to alanine at 143rd codon (G143A) (Bartlett et al., 2002). Other two point mutation at cytochrome b gene is the substitution of phenylalanine with leucine at po sition 129 (F129L) and glycine with arginine at position 137 (G137R) which confer QoI resistance (Fernà ¡ndez-Ortuà ±o et al. 2010). Another mechanism has also been identified that can bypass the blockage of electron transfer. Alternative oxidase (AOX) is a strobilurin-insensitive terminal oxidase which can bypass electron transfer in Complex III and Salicylhydroxamic acid (SHAM) is an active inhibitor of AOX (Wood and Hollomon, 2003). Resistant mechanism of C. sojina against QoI fungicides is associated with a mitochondrial genome which is present in multiple copies within a single cell. The coexistence of wild and mutated alleles in QoI resistant/sensitive locus has been reported in several other fungal pathogens such as Corynespora cassiicola, Collectotrichumgloeosporioides, Venturia inequalis and Mycovellosiella nattrassii (Ishii et al., 2007; Villani and Cox, 2014). The proportion of wild and mutant allele in the mitochondrial genome has a major role for quantitative resistance (Villani and Cox, 2014). Protective efficacy of the full dose of azoxystrobin against powdery and downy mildew has been found to decrease as populations contained 10% resistant isolates (Ishii et al., 2007). There have been reports of loss of resistance stability in the absence of selection pressure and vice versa (Fraaije et al., 2002; Ishii et al., 2007). The main objectives of this study are to i) identify heteroplasmy in Cercospora sojina; ii) monitor the proportion of resistant and sensitive allele in the presence of selection pressure in the laboratory; and, iii) study the sensitivity of C. sojina against azoxystrobin. Materials and Methods Isolate selection and development of single spore cultures Isolates of C. sojina were screened for resistant and sensitive allele using Taqman assay. After screening, three isolates each having resistant and sensitive alleles were chosen for single spore cultures. Isolates were transferred to V8-RA media and grown in dark cabinet to enhance sporulation. After three weeks, plated were flooded with water and filtered with muslin filter cloth. Water was observed under dissecting microscope to identify single spores. Sterilized needed were used to pick single spore and transferred to new V8-RA plates. Culture was left at room temperature, mycelium harvested, lyophilized and DNA was extracted. Radial growth study A total of two isolates: 158-1 (resistant) and 312-1 (sensitive) were selected for fungicide sensitivity and radial growth study. Four different concentrations of azoxystrobin including control were used to culture both isolates in two replications. Technical grade formulation of azoxystrobin (0.104 gm) (96% a.i.; Syngenta Crop Protection) was used to make 100,000 à µg a.i./ml stock in 1 ml acetone. Serial dilution was done to make four different concentration stocks: 10,000, 1000, 100 and 100 à µg a.i./ml. V8 media was prepared with four different concentrations (10, 1, 0.1, 0.01 à µg a.i./ml) by adding 1ml of respective fungicide stock in 1 liter of media. All four media along with control was amended with salicylhydroxamic acid (SHAM) at 60 à µg a.i./ml. Two straight line at 90o were drawn at the center of the plate. For resistant and sensitive isolates, a 5 mm mycelium disc was taken and placed at the center of amended plates in two replications. For each plate, diameters of growth were measured at the interval of 11, 21 and 30 days. Mycelium disc from amended plates was again transferred to the newly amended plate after 10 days. Diameters were measured similarly for three generations. Taqman assay and Sanger sequencing The G/C point mutation in cytochrome b gene will be discriminated by Taqman assay consisting of two dyes. VIC can detect resistant allele C and FAM can detect sensitive allele G. Threshold cycle or Ct of two dyes will be used in detecting the presence of two alleles in a single spore culture. Ct value is the cycle number at which the fluorescence generated crosses the threshold fluorescence and is inversely proportional to the amount of nucleic acid. Lower Ct indicates higher copies in the sample. Sanger sequencing will be done to confirm the presence of both alleles in a single spore. Two primers pairs (Forward: 5 CTCATTAAATTAGTAATAACTGTGGC 3 and Reverse: 5 TAATACAGCTTCAGCATTTTTCTTCT 3 ) will be used to amplify a part of cytochrome b gene. PCR reaction will be done in a total volume of 25 à µl consisting of 1.25 à µl (10 à µM) of each primer, 12.5 à µl of 2x Veriseq PCR mix (Enzymatics Inc.), 1.25 à µl DNA and 8.5 à µl water and run in following settings: initial denaturation at 94à ° C for 2 min followed by 29 cycles of denaturation at 94à ° C for 20 s, annealing at 55à ° C for 25 s, extension at 72à ° C for 1 min and final extension at 72à ° C for 10 min. Data analysis Sequences derived from Sanger sequencing will be aligned to publicly available cytochrome b gene of C. sojina. The QoI resistant/sensitive point mutation locus will be observed for Heterozygosity. The proportions of resistant and sensitive alleles will be calculated based on Ct values and statistical analysis will be performed to compare among different generations. The percent growth inhibition will be calculated as: ([colony diameter on control media 5 mm] [colony diameter on fungicide amended media 5 mm]) / ([colony diameter on control media 5 mm]) x 100. Further, radial growth of the same isolate among three generations and four different treatments will be compared statistically. Expected results This study will help to explore if heteroplasmy exists in C. sojina as in other Cercospora species. The proportion of resistant and sensitive isolates determines the extent of disease, so it is important to know this ratio. In vitro assay to check the sensitivity of isolates against azoxystrobin at different concentration in a different generation will help to understand the effect of selection pressure. Further measurement of resistant and sensitive proportion with qPCR would help to determine the change occurred in following generations. Genetic study after fungicide treatment will also contribute in identifying changes due to selection pressure. References Anesiadis T, Karaoglanidis G and Tzavellaà ¢Ã¢â ¬Ã Klonari K. 2003. Protective, curative and eradicant activity of the strobilurin fungicide azoxystrobin against Cercospora beticola and Erysiphe betae. Journal of Phytopathology 151(11à ¢Ã¢â ¬Ã 12):647-651. Balba H. 2007. Review of strobilurin fungicide chemicals. Journal of Environmental Science and Health Part B 42(4):441-451. Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer M and Parrà ¢Ã¢â ¬Ã Dobrzanski B. 2002. The strobilurin fungicides. Pest management science 58(7):649-662. Fernà ¡ndez-Ortuà ±o D, Torà ©s JA, De Vicente A and Pà ©rez-Garcà a A. 2010. Mechanisms of resistance to QoI fungicides in phytopathogenic fungi. International Microbiology 11(1):1-9. Fraaije B, Butters J, Coelho J, Jones D and Hollomon D. 2002. Following the dynamics of strobilurin resistance in Blumeria graminis f. sp. tritici using quantitative alleleà ¢Ã¢â ¬Ã specific realà ¢Ã¢â ¬Ã time PCR measurements with the fluorescent dye SYBR Green I. Plant pathology 51(1):45-54. Fungicide Resistant Action Committee. 2013. List of plant pathogenic organisms resistant to disease control agents. http://www.frac.info/docs/default-source/publications/list-of-resistant-plant-pathogens/list-of-resistant-plant-pathogenic-organismsfebruary-2013.pdf?sfvrsn=4. Ishii H, Yano K, Date H, Furuta A, Sagehashi Y, Yamaguchi T, Sugiyama T, Nishimura K and Hasama W. 2007. Molecular characterization and diagnosis of QoI resistance in cucumber and eggplant fungal pathogens. Phytopathology 97(11):1458-1466. Villani SM and Cox KD. 2014. Heteroplasmy of the cytochrome b gene in Venturia inaequalis and its involvement in quantitative and practical resistance to trifloxystrobin. Phytopathology 104(9):945-953. Vincelli P. 2012. QoI (Strobilurin) Fungicides: Benefits and Risks. The Plant Health Instructor. DOI: 10.1094/PHI-I-2002-0809-0. Wood PM and Hollomon DW. 2003. A critical evaluation of the role of alternative oxidase in the performance of strobilurin and related fungicides acting at the Qo site of complex III. Pest management science 59(5):499-511.
Saturday, July 20, 2019
Femininity Essay -- essays research papers
The New Femininity Femininity is not a word that we are encouraged to use these days. A lot of people would argue that femininity is the thing that keeps women obedient to men. However, there is a hidden assumption behind this term. The assumption is that masculinity is superior to femininity; that femininity is not a beautiful and powerful thing in its own right. I believe that women have something men do not have. Women have special qualities that belong to them as women, and they do not intend to suppress those special qualities. I think the world would be a much poorer place without femininity. ?gWhat means to be a womanh What first came to my mind was stereotypical. Passive, dependent, altruistic, intuitive emotionally open, and impulsive?cis this what meant to be the ideal women in our society? In general, men have more power in the public place such as economic and political order, while women have more power in the private place such as domestic life, family. The social whole will be best suited if each sex does those tasks for which they are best suited. In fact, men and women have biologically different capacities and interests (aggressive vs. maternal feelings, etc) In the role of the family, men have power in making decision and the women have control of housework. ?@?@?@?@I had encountered to see the different aspects of gender role in two societies. These two societies have their own values and beliefs that keep the man and the women different. However, th...
Chef :: essays research papers
Chef This epic tale of love and deception takes us back in time to the year nineteen hundred and eighty seven. Early one morning in London, England, we find ourselves in the kitchen of Chef. This sweet mouthwatering scent of Salisbury steak fills the room. This was to be the finest steak Chef had ever prepared. He planned to enter a contest with this masterpiece, the prize being a cruise to Greenland. To Chef, this was the land of paradise. He would be the only man there to seduce and womanize the native females. The oven bell rang. The Salisbury steak was done to perfection. He rushed it to his finest Tupperware to the judges mouths. They chewed and gagged, but due to lack of contestants he won. He now had earned his passage to Greenland, and broke out in song. Time passed and the day of the cruise had arrived. It was time to board the ship. Dressed in his finest crushed velvet robe and lucky Chef’s hat, he set off. As the ship set away the Chef wandering the decks, taking in all of the sights and sounds. There on the main deck, he found his favorite spot. Shedding his robe, he stood in his fluorescent pink G-string. He approached a beautiful women sunning herself. He seductively blurted out “Woman your body is screaming for the oily touch of my strong black hands.'; At that moment she bursts into tears. He asked, “What’s wrong baby?'; She then explained to him that her name was Cartman, Mrs. Cartman. She had been forced into engagement with not only Mr. Garrison but Mr. Hat as well. The sorrow this caused her was too great, so she planned to end her life. The Chef then uttered back to her “Woman that would be a crime to ugly up a fine body like yours, let me take your picture and send to a fine quality, readin g periodical.'; Surprised at the offer she accepted. The Chef then escorted her to a more proper setting of his room. As he properly positioned her upon the couch, the Chef realized that he had no camera. Thinking quickly, he remembered the colored pencil he had in pocket. He knew it would be perfect, but still he asked, “Would mind if I traced the curves of your body with my dark colored pencil.'; She replied with an exciting giggle.
Friday, July 19, 2019
Base Details :: essays research papers
BASE DETAILS - ESSAY In the poem, "Base Details", SiegFried Sassoon expresses his great disgust towards the majors in the military. He is horrified and appalled at the way the majors act while men are dying out in the battle field. Mr. Sassoon is so furious towards the majors that it takes more than just one word to describe how indignified Sassoon is. These great feelings of anger are derived from the fact that the majors are living a life of luxury while sending young men "up the line" out into the battle field. This is all suggested in the title of the poem with the word "base" suggesting a military base, and/or a base person. And the word "details" suggesting a command, an assignment, and something or someone lowly. "Base Details" is a poem which expresses the feelings of the author towards military majors using differentiable types of imagery. The poem begins by Sassoon describing the majors as demanding, mean, and belligerent men. Bald, out-of-shape and full of gluttony. Sassoon categorizes the majors under the word scarlet signifying childless, bright redness from excessive drinking and yelling of anger. Sassoon presents to us the fact of the majors sending up the young men as soon as they are drafted "up the line to death." This attitude taken from the majors is what angers Sassoon to the point of hatred. To convince the reader of such horrific truth, Sassoon describes how disrespectful the majors are with their "puffy petulant faces" from eating and drinking excessively. Sassoon states how the majors are stuffing their faces and "Reading the Roll of Honor" in safe luxurious hotels while men are dying out on the field. For this, Sassoon feels so contemptuous towards the majors for they are demanding but hypocritical. They give out strict orders and boss soldiers around while they sit down and be tyrannical. They are just so barbaric and arrogant and show so much disrespect for those who have died in battle that it is not only ridicules to Sassoon but probably for the reader as well. It is just so unbelievable how these majors can sit scarlet and short of breath belittling and not recognizing the heroic actions of the men in the battle field by referring to them as "poor young chaps." When in comfort smoking their cigars, they use words which are definitely not suitable for the conditions.
Thursday, July 18, 2019
In the Heart of the Sea
In the Heart of the Sea The novel ââ¬Å"In the Heart of the Sea: The Tragedy of the Whaleship Essex,â⬠by Nathaniel Philbrick, successfully tells the story of the whale ship Essex that was attacked by a sperm whale 1,500 nautical miles west of the Galapagos, 40 miles south of the equator. Many people know this as the story of ââ¬Å"Moby Dickâ⬠, which was based off this event. The novel highlights three themes: man versus nature, survival, and suffering. The novel starts out in the town of Nantucket, an island off the eastern coast of New England.Nantucket, at this time, is known as one of the most successful whaling ports. Docked on the port was the famous Essex, a 20 year whaling boat. The Essex is the pride of Nantucket. It is 87 feet long, 238 tons, equipped with 12 sails and carried several smaller whaling boats that were used when a whale was spotted. After lasting many years, the Essex developed a reputation for being a lucky ship. Many voyages lasted around two to three years in the Pacific Ocean. Many young boys, such as Thomas Nickerson, joined whaling crews at a young age.These crews were mixed of experienced whalers and ââ¬Å"green hands,â⬠men who have never sailed on a whaling ship. Usually, these new crew members would earn around $150 for two years work, so the experienced workers made the most of these ââ¬Å"green hands. â⬠Nantucket was known for its whale products, and was considered the whaling capital of the world. Whale oil was used to fuel lamps and making lamps (because there is no electricity, gas or kerosene). It is also used in margarine, shoe polish and soap. Baleen is a substance that comes from the mouths of the whale.They can be found in many womenââ¬â¢s clothing. These two important goods come from whales and the only way to obtain the oil and baleen is to make a voyage out to see and find the whales. At the beginning of the novel, we are introduced to the town of Nantucket and whaling business. His disc ussions of this set us up for the events following later in the book. Philbrick also talks about the relationship between the colonists in Nantucket. They are very close, drawn together by their Quaker religion, similar experiences, and their interests in whaling.In the town, there is a hierarchy within the people. Where a person lived in the town was based on what rank they are in their society. The captainââ¬â¢s home would usually have the best view of the harbor. The seven black crewmen who were brought over to the crew were out casted, and relied on each other. The novel highlights the dangers of being a whaler. Young crewmen, such as Nickerson, were there to gain experience for future journeys. Nantucket was brought together by the whaling industry, and the community would usually see ships off before they took off.The Essex sailed off from Nantucket on August 12, 1819 under the command of 28 year-old Captain George Pollard, Jr. He spent the last four years on the Essex, and knew it very well. However, Philbrick points out that Pollard was not ready for be a captain, and we see why later on in the book. Owen Chase is the captainââ¬â¢s first mate, and Matthew Joy was the second mate. The Essex was operated with a 21-man crew. In chapter 2, Philbrick describes the ship. Also, in this chapter, we get a feel for the isolation of the ââ¬Å"outsiders. The captain and his mates would sleep in cabins that were in the back of the ship, next, the Nantucket colonists would stay in the steerage, and the blacks, separated by the blubber room, stayed in front of the boat. After they embark on their journey, the men begin to complain about their rations. Pollard, was able to talk them into settling for what they had, establishing his power and authority. In chapter 5, on November 20, the crew spots whales 40 miles south of the equator. Chase and his crew go after a whale, which destroys their boat with its tail.When they bring their boat back to the Essex, they s pot a huge sperm whale near the bow of the ship calmly and quietly floating along the surface of the water. The whale began to move quickly towards the ship. The men try to steer Essex away from the whale, but are unsuccessful. The whale rams the ship with its head, and the men are amazed. After the whale revives itself, it struck the ship again, causing the Essex to sink bow-first. The men board their whaleboats after a night of preparation of leaving the Essex. They stripped the sails of the ship and attached them to their boats.The waves splashed over the boat, causing the work to be more difficult. The next morning, the boats take off. Chase and Pollard talk of where to go now that their ship has sunk. They speak about going to the Galapagos Islands, but Pollard noticed the wind direction would not allow them to go there. Next, they speak about the Marquesas, in the west. The men had heard that the inhabitants of the island were cannibals. South of the Marquesas were the Tauamot u Archipelago Islands, but the men had also heard that the islands have a bad reputation.In this conversation, we notice the colonistââ¬â¢s outlook on the unknown. They share a sense of togetherness within each other and no one else. We see this in the attitude of the colonists towards the black crewmen. Pollard decides to sail towards the Society Islands. There, Pollard saw a safer environment with little threat. Chase and Joy argue that the Society Islands would not be a good place to sail towards, and they could sail towards Chile or Peru instead. Pollard conforms to this decision. Here we see that Pollard has become less authoritative after the Essex sinks.In their first three weeks in the boats, the men faced many hardships. They faced thirst and hunger. Their skin had been burnt, salt water burned their sores, and the men, being as weak as they were, were unable to row the boats. On top of all that, another whale attacks Pollardââ¬â¢s boat. The men spot an island in the distance and conclude that they have arrived at Henderson Island. There, they found fresh water and ate crabs and birds. They were able to revive themselves, and this gave them a fighting chance of survival. Three men chose to stay on the island while the others left.Pollard promised he would rescue them after he reached South America. They return back to the ocean, and the men face the same obstacles they faced before they found Henderson Island. The men faced hunger but were still hydrated from the water collected at Henderson Island. Many accepted they werenââ¬â¢t going to live, and gave up their rations. Joy dies in the voyage, and the men bury him at dead. Bad turns to worse when the men realize there is only enough hardtack to last a day or two. On January 20, Lawson Thomas, a black crew member, dies, and the crew contemplates turning to cannibalism.The men concluded that in order to survive, they must eat the dead crew members. It is ironic that the men turned to cannibali sm, because they feared the inhabitants of the Marquesas. Three months after the Essex sank; the remaining two whaleboats are rescued in different areas along the South American coast. Two men were left alive in Pollardââ¬â¢s boat and three men in Chaseââ¬â¢s boat. Nickerson, Chase, and Lawrence arrive in Valparaiso, Chile on February 25, 1821, and are taken back to Nantucket aboard whale ship Hero.Both Nantucket and the survivors of the Essex changed after the shipââ¬â¢s sinking. The whaling industry quickly fell to other towns. A fire that burned nearly a third of the town added to the difficulties. The men of the Essex were haunted when recalling what happened. Even Chase was deemed insane. This event caused the town of Nantucket to separate. The townspeople were no longer bonded by whaling, because the industry made a fall. The surviving men of the Essex became hypocritical, turning to cannibalism, one thing they feared and frowned upon. This event helps us understand w hat these men had to do when they are stranded, and teaches us the meaning of nature, survival, and suffering.Bibliography ââ¬Å"Alone in the Pacific. â⬠Salariya Publishing. Web. 18 Oct. 2010. <http://www. salariya. com/web_books/whaling/alone/alone. html>. ââ¬Å"Nantucket Island History. â⬠Nantucket Island Chamber of Commerce. Web. 18 Oct. 2010. <http://www. nantucketchamber. org/visitor/trivia. html>. Philbrick, Nathaniel. In the Heart of the Sea: The Tragedy of the Whaleship. New York,NY: Penguin, 2000. Print. In the Heart of the Sea Nicole Hart HIST 2300- Christopher Trobridge Writing Assignment One October 16, 2010 ââ¬Å"In the Heart of the Sea: The Tragedy of the Whale ship Essexâ⬠In order to understand the ramifications of an event such as the sinking of the Essex one needs too understand the community that produces the crew. Nantucket was an island community much more than the literal sense of word. The islanders of Nantucket saw themselves differently than the rest of the word. They learned the skills of whaling from the original Wampanoag tribe. They were Quakers with a stoic sense of standards and community.The whale men from Nantucket saw themselves as superior to most other sailors of that time period. Hardship and perseverance were virtues held by the whale men and the women. The women ran the town while the whale men were at sea for years at a time. This type of work ethic and fortitude, and the worlds desire for oil, combined to make ââ¬Å"the village of Nantucket one of the richest towns in America. â⬠ââ¬Å"In the Heart of the Seaâ⬠It also created a close-knit community with a few very successful and influential families that married with each other maintaining a strong central hierarchy.The sinking of the Essex directly affected the community of Nantucket but it was also far reaching to the rest of the country. America was growing as a Nation and its consumption of oil was expanding. The events of the Essex were not only interesting to sailors of the world but also to the mainlanders that consumed the oil. America in the eighteenth century and the early nineteenth century were considered ââ¬Å"â⬠¦a consumer revolution. â⬠ââ¬Å"Of the Peopleâ⬠No one knew this fact better than the owners of the whale ships. They understood that whale oil was a commodity to be sold.In order to harvest it at a profit they had to balance their expenses. Every mate on a whale ship received a fraction of the profit that the whale ship would return with the oil it found. The more responsibility a sailor had on a whale ship, the larger his cut. Every expense, food, gear, clothing, water had to be factored in of doing business. For example the captain received the largest share, due to him having the most responsibility, while Thomas Nickersonââ¬â¢s share was the experience he received at a young age on a whale ship plus the room and board that he would receive for two to three years.A situation that occurred early in their journey was a foreboding of things to come. Weeks into there journey the Essex experienced a ââ¬Å"Knockdownâ⬠, a knockdown is a severe weather event that led to damage of the Essex. Captain Pollard was slow to respond to the weather issue at hand. The result was damage to half of their whaleboats that they used to harpoon whales. After the damage was done Pollard felt it would be best to return to Nantucket to replenish the ship with a new compliment of whaleboats.First mate Owen Chase convinced the Captain to p roceed on with the whale boats they had with hope of getting more whaleboats of the coast of Africa. This dynamic exposed the type of sailor Captain Pollard was and the type of sailor first mate Chase was. Captain Pollard was proving to be ââ¬Å"a Captain that had the skills of a first mate and first mate Owen was showing to have the skills of a Captain. â⬠ââ¬Å"In the Heart of the Sea. â⬠These two personalities would continue to show themselves later in there journey after the Essex had sunk. When the Essex was rammed and destroyed by the sperm whale, the crews Nantucket heritage served them well.The officers of the Essex were able to maintain order and stifle any panic by the crewmen. They devised a strategy that first mate Chase had championed. Once again Captain Pollardââ¬â¢s initial plan was shelved for fist mate Chaseââ¬â¢s plan. The remaining twenty-crew members of the Essex were split into three twenty-five foot whaling boats. Captain Pollard, First mate Chase, and Second officer Hendrix were in charge of the three boats. Even in this situation, a strong sense of the Nantucket community was resident in the division of each boat.The majority of the Nantucketers ended up in Captain Pollards boat. A few of the remaining Nantucketers ended up in First mate Chaseââ¬â¢s boat and the majority of African American sailors ended up in second mate Hendrixââ¬â¢s boat. First mate Owen Chase proved to be a relentless advocate for hope. Thomas Nickerson saw another side of First mate Chase when their journey first began by seeing how curt Chase was to the crew. On the island of Nantucket Owen Chase was a gentlemen but at sea Chase took a role of being very demanding and wanting things done correctly.After the sinking of the Essex the crewmembers were struggling with the situation they were in and Chase changed his method of handling of the crew. When Chase saw the crew was losing spirit he showed a more ââ¬Å"maternalâ⬠side. This chan ge in attitude was critical in the survival of the crewmembers that made it. The events that led to the cannibalism of crewmembers of the Essex were presented differently to Captain Pollardââ¬â¢s boat and first mate Chaseââ¬â¢s boat. Captain Pollards and Hendrix boat became separated from Chases boat.The African American crewmembers having a low body fat content and a mineral deficient diet became prone to death before the Nantucket crewmembers. As the African American crewmembers died the living crewmembers consumed them. When there only living crew members left on Pollards boat they resorted to drawing lots to see who would give up their life as food and who would kill that sailor. On first mate Chaseââ¬â¢s boat one of the sailors passes and the elect to consume his body. It appears that cannibalism was a common event that occurred in these situations.To this day human beings get presented with this dilemma, such as the plane crash in the Andes. As for me I would rather c hose death than the consuming of my mates. Spending months at a time with these men I would feel as though I was eating a family member and would rather wait for death than eat a fellow mate. Although I would have the pressure of supporting my family and wanting to return home, eating a human being I believe would be a lot easier said then done. In the grief that Captain Pollard experienced having to eat his nephew then facing his Aunt would be something I donââ¬â¢t think I could endure or ever live with.For Nantucket and the men involved in whale hunting it is more than just a hunt. It was a way of life, a way of survival, and the entire focus of a town. This novel contained more than just the story of the ramming of the Essex, it was more of a story of the hardships faced, the dedication that comes with the job of whaling, and the raw emotions of the men involved. This novel proved the importance of whaling in that time period to not only Nantucket but to the entire Nation, and how it foreshadowed how our economy would be today.Lastly to end with the mission of the Nantucket Quakers ââ¬Å"â⬠¦to maintain a peaceful life on land while raising bloody havoc at sea. â⬠This was their life, their survival and it now is their history. Works Cited James Oakes, Michael Mcgerr, Jan Ellen Lewis, Nick Cullather, Jeanne Boydston. ââ¬Å"Of the People: A history of the United States. â⬠New York: Oxford University Press. Nathaniel Philbrick. ââ¬Å"In the heart of the sea:The tradgedy of the Whaleship Essexâ⬠New York: Penguin Books, 2000.
Subscribe to:
Posts (Atom)